Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene
PTXBC008487
New product
Data sheet of MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008487 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MS4A3 |
| Origin species: | Human |
| Product name: | MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene |
| Size: | 2ug |
| Accessions: | BC008487 |
| Gene id: | 932 |
| Gene description: | membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) |
| Synonyms: | CD20L; HTM4; membrane-spanning 4-domains subfamily A member 3; CD20 antigen homolog; CD20 antigen-like protein; IgE receptor beta chain; IgE receptor beta subunit; hematopoietic cell 4 transmembrane protein; hematopoietic-specific transmembrane protein 4; membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific); membrane spanning 4-domains A3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctcccacgaagttgataatgcagagctggggtcagcctctgcccatggtaccccaggcagtgaggcgggaccagaagagctgaatacttctgtctaccagcccatagatggatcaccagattatcagaaagcaaaattacaagttcttggggccatccagatcctgaatgcagcaatgattctggctttgggtgtctttctgggttccttgcaatacccataccacttccaaaagcacttctttttcttcaccttctacacaggctacccgatttggggtgctgtgtttttctgtagttcaggaaccttgtctgttgtagcagggataaaacccacaagaacatggatacagaacagttttggaatgaacattgccagtgctacaattgcactagtggggactgcttttctctcactaaatatagcagttaatatccagtcattaaggagttgtcactcttcatcagagtcaccggacctatgcaattacatgggctccatatcaaatggcatggtgtctctactgctgattctcaccttgctggaattatgcgtaaccatctctaccatagccatgtggtgcaatgcaaactgctgtaattcaagagaggaaatttcctcacctcccaattctgtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) - signal transducer and activator of transcription 3 (acute-phase response factor) - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9) - TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa |