MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene View larger

MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene

PTXBC008487

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008487
Product type: DNA & cDNA
Ncbi symbol: MS4A3
Origin species: Human
Product name: MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene
Size: 2ug
Accessions: BC008487
Gene id: 932
Gene description: membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)
Synonyms: CD20L; HTM4; membrane-spanning 4-domains subfamily A member 3; CD20 antigen homolog; CD20 antigen-like protein; IgE receptor beta chain; IgE receptor beta subunit; hematopoietic cell 4 transmembrane protein; hematopoietic-specific transmembrane protein 4; membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific); membrane spanning 4-domains A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctcccacgaagttgataatgcagagctggggtcagcctctgcccatggtaccccaggcagtgaggcgggaccagaagagctgaatacttctgtctaccagcccatagatggatcaccagattatcagaaagcaaaattacaagttcttggggccatccagatcctgaatgcagcaatgattctggctttgggtgtctttctgggttccttgcaatacccataccacttccaaaagcacttctttttcttcaccttctacacaggctacccgatttggggtgctgtgtttttctgtagttcaggaaccttgtctgttgtagcagggataaaacccacaagaacatggatacagaacagttttggaatgaacattgccagtgctacaattgcactagtggggactgcttttctctcactaaatatagcagttaatatccagtcattaaggagttgtcactcttcatcagagtcaccggacctatgcaattacatgggctccatatcaaatggcatggtgtctctactgctgattctcaccttgctggaattatgcgtaaccatctctaccatagccatgtggtgcaatgcaaactgctgtaattcaagagaggaaatttcctcacctcccaattctgtgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase)
- signal transducer and activator of transcription 3 (acute-phase response factor)
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9)
- TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa

Buy MS4A3-membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) Gene now

Add to cart