BAAT-bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) Gene View larger

BAAT-bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BAAT-bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BAAT-bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009567
Product type: DNA & cDNA
Ncbi symbol: BAAT
Origin species: Human
Product name: BAAT-bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) Gene
Size: 2ug
Accessions: BC009567
Gene id: 570
Gene description: bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase)
Synonyms: BACAT; BAT; bile acid-CoA:amino acid N-acyltransferase; bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase); bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase); long-chain fatty-acyl-CoA hydrolase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatccagttgacagctacccctgtgagtgcacttgttgatgagccagtgcatatccaagctacaggcctgattccctttcagatggtgagttttcaggcatcactggaagatgaaaacggagacatgttttattctcaagcccactatagggccaatgaattcggtgaggtggacctgaatcatgcttcttcacttggaggggattatatgggagtccaccccatgggtctcttctggtctctgaaacctgaaaagctattaacaagactgttgaaaagagatgtgatgaataggcctttccaggtccaagtaaaactttatgacttagagttaatagtgaacaataaagttgccagtgctccaaaggccagcctgactttggagaggtggtatgtggcacctggtgtcacacgaattaaggttcgagaaggccgccttcgaggagctctctttctccctccaggagagggtctcttcccaggggtaattgatttgtttggtggtttgggtgggctgcttgaatttcgggccagcctcctagccagtcgtggcttcgcctccttggccttggcttaccataactatgaagacctgccccgcaaaccagaagtaacagatttggaatattttgaggaggctgccaactttctcctgagacatccaaaggtctttggctcaggcgttggggtagtctctgtatgtcaaggagtacagattggactatctatggctatttacctaaagcaagtcacagccacggtacttattaatgggaccaactttccttttggcattccacaggtatatcatggtcagatccatcagccccttccccattctgcacaattaatatccaccaatgccttggggttactagagctctatcgcacttttgagacaactcaagttggggccagtcaatatttgtttcctattgaagaggcccaggggcaattcctcttcattgtaggagaaggtgataagactatcaacagcaaagcacacgctgaacaagccataggacagctgaagagacatgggaagaacaactggaccctgctatcttaccctggggcaggccacctgatagaacctccctattctcctctgtgctgtgcctcaacgacccacgatttgaggttacactggggaggagaggtgatcccacacgcagctgcacaggaacatgcttggaaggagatccagagatttctcaggaagcacctcattccagatgtgaccagtcaactctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - signal transducer and activator of transcription 3 (acute-phase response factor)
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9)
- TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
- signal transducer and activator of transcription 3 (acute-phase response factor)

Buy BAAT-bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) Gene now

Add to cart