DENR-density-regulated protein Gene View larger

DENR-density-regulated protein Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DENR-density-regulated protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DENR-density-regulated protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007860
Product type: DNA & cDNA
Ncbi symbol: DENR
Origin species: Human
Product name: DENR-density-regulated protein Gene
Size: 2ug
Accessions: BC007860
Gene id: 8562
Gene description: density-regulated protein
Synonyms: DRP; DRP1; SMAP-3; density-regulated protein; smooth muscle cell associated protein-3; density regulated re-initiation and release factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctgacatttctgaatccagcggggctgactgcaaaggagacccaaggaacagtgccaagttagatgccgattacccacttcgagtcctttattgtggagtctgttcattaccaacagagtactgtgaatatatgcctgatgttgctaaatgtagacaatggttagagaagaattttccaaatgaatttgcaaaacttactgtagaaaattcacccaaacaagaagctggaattagtgagggtcaaggaacagcaggggaagaagaggagaagaaaaaacagaagagaggtggaaggggtcaaataaaacaaaaaaagaagaccgtaccacaaaaggttactatagccaaaattcccagagcaaagaagaaatatgtgacaagagtatgtggccttgcaacttttgaaattgatcttaaagaagcacaaagattttttgctcaaaaattctcctgtggtgcctcagtaacaggggaggatgaaattatcattcagggagattttacagatgacataattgatgtcattcaggaaaaatggccagaggtagatgatgacagcatcgaagatcttggagaagtaaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 323
- PARK2 co-regulated-like
- zinc finger protein 672
- ring finger protein 114

Buy DENR-density-regulated protein Gene now

Add to cart