Login to display prices
Login to display prices
DENR-density-regulated protein Gene View larger

DENR-density-regulated protein Gene

PTXBC007860

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DENR-density-regulated protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DENR-density-regulated protein Gene

Proteogenix catalog: PTXBC007860
Ncbi symbol: DENR
Product name: DENR-density-regulated protein Gene
Size: 2ug
Accessions: BC007860
Gene id: 8562
Gene description: density-regulated protein
Synonyms: DRP; DRP1; SMAP-3; density-regulated protein; smooth muscle cell associated protein-3; density regulated re-initiation and release factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgctgacatttctgaatccagcggggctgactgcaaaggagacccaaggaacagtgccaagttagatgccgattacccacttcgagtcctttattgtggagtctgttcattaccaacagagtactgtgaatatatgcctgatgttgctaaatgtagacaatggttagagaagaattttccaaatgaatttgcaaaacttactgtagaaaattcacccaaacaagaagctggaattagtgagggtcaaggaacagcaggggaagaagaggagaagaaaaaacagaagagaggtggaaggggtcaaataaaacaaaaaaagaagaccgtaccacaaaaggttactatagccaaaattcccagagcaaagaagaaatatgtgacaagagtatgtggccttgcaacttttgaaattgatcttaaagaagcacaaagattttttgctcaaaaattctcctgtggtgcctcagtaacaggggaggatgaaattatcattcagggagattttacagatgacataattgatgtcattcaggaaaaatggccagaggtagatgatgacagcatcgaagatcttggagaagtaaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: