RNF185-ring finger protein 185 Gene View larger

RNF185-ring finger protein 185 Gene

PTXBC009504

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF185-ring finger protein 185 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF185-ring finger protein 185 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009504
Product type: DNA & cDNA
Ncbi symbol: RNF185
Origin species: Human
Product name: RNF185-ring finger protein 185 Gene
Size: 2ug
Accessions: BC009504
Gene id: 91445
Gene description: ring finger protein 185
Synonyms: E3 ubiquitin-protein ligase RNF185; BSK65-MONO1; BSK65-MONO2; BSK65-PANC1; BSK65-PANC2; BSK65-TEST1; BSK65-TEST2; BSK65-TEST3; ring finger protein 185
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaagcaaggggccctcggcctctgcatctcctgagaactccagtgcaggggggcccagtgggagcagcaatggcgctggcgagagcggagggcaggacagcactttcgagtgcaacatctgcttggacacagccaaggatgccgtcatcagcctgtgtggccacctcttctgttggccgtgtttacatcagtggttggagaccagacctaacagacaggtgtgtcctgtttgcaaagctggcatcagccgagacaaggtcatccccctctatggaaggggcagcactgggcaacaggaccccagagagaagacccctcctcgtcctcaaggacagaggccagagccggagaatagagggggatttcaaggatttggatttggagatggtggcttccagatgtcttttggaattggggcatttccctttgggatatttgccacagcatttaatataaatgatgggcggcctcctccagctgtccctgggacaccccagtatgtggacgagcagttcctgtcacgcctcttcctatttgtggccctggtgatcatgttctggctcctgattgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GM2 ganglioside activator
- density-regulated protein
- zinc finger protein 323
- PARK2 co-regulated-like

Buy RNF185-ring finger protein 185 Gene now

Add to cart