Login to display prices
Login to display prices
GPR65-G protein-coupled receptor 65 Gene View larger

GPR65-G protein-coupled receptor 65 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPR65-G protein-coupled receptor 65 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPR65-G protein-coupled receptor 65 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035633
Product type: DNA & cDNA
Ncbi symbol: GPR65
Origin species: Human
Product name: GPR65-G protein-coupled receptor 65 Gene
Size: 2ug
Accessions: BC035633
Gene id: 8477
Gene description: G protein-coupled receptor 65
Synonyms: hTDAG8; psychosine receptor; T-cell death-associated gene 8 protein; G protein-coupled receptor 65
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacagcacatgtattgaagaacagcatgacctggatcactatttgtttcccattgtttacatctttgtgattatagtcagcattccagccaatattggatctctgtgtgtgtctttcctgcaagcaaagaaggaaagtgaactaggaatttacctcttcagtttgtcactatcagatttactctatgcattaactctccctttatggattgattatacttggaataaagacaactggactttctctcctgccttgtgcaaagggagtgcttttctcatgtacatgaatttttacagcagcacagcattcctcacctgcattgccgttgatcggtatttggctgttgtctaccctttgaagttttttttcctaaggacaagaagatttgcactcatggtcagcctgtccatctggatattggaaaccatcttcaatgctgtcatgttgtgggaagatgaaacagttgttgaatattgcgatgccgaaaagtctaattttactttatgctatgacaaataccctttagagaaatggcaaatcaacctcaacttgttcaggacgtgtacaggctatgcaatacctttggtcaccatcctgatctgcaaccggaaagtctaccaagctgtgcggcacaataaagccacggaaaacaaggaaaagaagagaatcataaaactacttgtcagcatcacagttacttttgtcttatgctttactccctttcatgtgatgttgctgattcgctgcattttagagcatgctgtgaacttcgaagaccacagcaattctgggaagcgaacttacacaatgtatagaatcacggttgcattaacaagtttaaattgtgttgctgatccaattctgtactgttttgtaaccgaaacaggaagatatgatatgtggaatatattaaaattctgcactgggaggtgtaatacatcacaaagacaaagaaaacgcatactttctgtgtctacaaaagatactatggaattagaggtccttgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 20 receptor beta
- LY6/PLAUR domain containing 4
- RAN, member RAS oncogene family
- melanoma antigen family H, 1