SELT-selenoprotein T Gene View larger

SELT-selenoprotein T Gene

PTXBC036738

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SELT-selenoprotein T Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SELT-selenoprotein T Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036738
Product type: DNA & cDNA
Ncbi symbol: SELT
Origin species: Human
Product name: SELT-selenoprotein T Gene
Size: 2ug
Accessions: BC036738
Gene id: 51714
Gene description: selenoprotein T
Synonyms: SELT; selenoprotein T
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagtacgccacggggccgctgctcaagttccagatttgtgtttcctgaggttataggcgggtgtttgaggagtacatgcgggttattagccagcggtacccagacatccgcattgaaggagagaattacctccctcaaccaatatatagacacatagcatctttcctgtcagtcttcaaactagtattaataggcttaataattgttggcaaggatccttttgctttctttggcatgcaagctcctagcatctggcagtggggccaagaaaataaggtttatgcatgtatgatggttttcttcttgagcaacatgattgagaaccagtgtatgtcaacaggtgcatttgagataactttaaatgatgtacctgtgtggtctaagctggaatctggtcaccttccatccatgcaacaacttgttcaaattcttgacaatgaaatgaagctcaatgtgcatatggattcaatcccacaccatcgatcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sideroflexin 1
- tetraspanin 7
- tetraspanin 3
- actin, gamma 1

Buy SELT-selenoprotein T Gene now

Add to cart