TSPAN3-tetraspanin 3 Gene View larger

TSPAN3-tetraspanin 3 Gene

PTXBC004280

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN3-tetraspanin 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN3-tetraspanin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004280
Product type: DNA & cDNA
Ncbi symbol: TSPAN3
Origin species: Human
Product name: TSPAN3-tetraspanin 3 Gene
Size: 2ug
Accessions: BC004280
Gene id: 10099
Gene description: tetraspanin 3
Synonyms: TM4-A; TM4SF8; TSPAN-3; tetraspanin-3; tetraspan 3; tetraspan TM4SF; tetraspanin TM4-A; transmembrane 4 superfamily member 8; tetraspanin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccagtgcggcatcacctcctccaagaccgtgctggtctttctcaacctcatcttctggggggcagctggcattttatgctatgtgggagcctatgtcttcatcacttatgatgactatgaccacttctttgaagatgtgtacacgctcatccctgctgtagtgatcatagctgtaggagccctgcttttcatcattgggctaattggctgctgtgccacaatccgggaaagtcgctgtggacttgccacgtttgtcatcatcctgctcttggtttttgtcacagaagttgttgtagtggttttgggatatgtttacagagcaaaggtggaaaatgaggttgatcgcagcattcagaaagtgtataagacctacaatggaaccaaccctgatgctgctagccgggctattgattatgtacagagacagctgcattgttgtggaattcacaactactcagactgggaaaatacagattggttcaaagaaaccaaaaaccagagtgtccctcttagctgctgcagagagactgccagcaattgtaatggcagcctggcccacccttccgacctctatgctgaggggtgtgaggctctagtagtgaagaagctacaagaaatcatgatgcatgtgatctgggccgcactggcatttgcagctattcagctgctgggcatgctgtgtgcttgcatcgtgttgtgcagaaggagtagagatcctgcttacgagctcctcatcactggcggaacctatgcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actin, gamma 1
- actin-like 6A
- olfactomedin 2
- SREBF chaperone

Buy TSPAN3-tetraspanin 3 Gene now

Add to cart