SFXN1-sideroflexin 1 Gene View larger

SFXN1-sideroflexin 1 Gene

PTXBC020517

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFXN1-sideroflexin 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SFXN1-sideroflexin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020517
Product type: DNA & cDNA
Ncbi symbol: SFXN1
Origin species: Human
Product name: SFXN1-sideroflexin 1 Gene
Size: 2ug
Accessions: BC020517
Gene id: 94081
Gene description: sideroflexin 1
Synonyms: TCC; sideroflexin-1; tricarboxylate carrier protein; sideroflexin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattttgataggaagaatgtcagcccaggttcccatgaacatgaccatcacaggttgtatgatgacgttttacaggactacgccggctgtgctgttctggcagtggattaaccagtccttcaatgccgtcgtcaattacaccaacagaagtggagacgcacccctcactgtcaatgagttgggaacagcttacgtttctgcaacaactggtgccgtagcaacagctctaggactcaatgcattgaccaagcatgtctcaccactgataggacgttttgttccctttgctgccgtagctgctgctaattgcattaatattccattaatgaggcaaagggaactcaaagttggcattcccgtcacggatgagaatgggaaccgcttgggggagtcggcgaacgctgcgaaacaagccatcacgcaagttgtcgtgtccaggattctcatggcagcccctggcatggccatccctccattcattatgaacactttggaaaagaaagcctttttgaagaggttcccatggatgagtgcacccattcaagttgggttagttggcttctgtttggtgtttgctacacccctgtgttgtgccctgtttcctcagaaaagttccatgtctgtgacaagcttggaggccgagttgcaagctaagatccaagagagccatcctgaattgcgacgcgtgtacttcaataagggattgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetraspanin 7
- tetraspanin 3
- actin, gamma 1
- actin-like 6A

Buy SFXN1-sideroflexin 1 Gene now

Add to cart