Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TNNC1-troponin C type 1 (slow) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNNC1-troponin C type 1 (slow) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030244 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNNC1 |
| Origin species: | Human |
| Product name: | TNNC1-troponin C type 1 (slow) Gene |
| Size: | 2ug |
| Accessions: | BC030244 |
| Gene id: | 7134 |
| Gene description: | troponin C type 1 (slow) |
| Synonyms: | CMD1Z; CMH13; TN-C; TNC; TNNC; troponin C, slow skeletal and cardiac muscles; cardiac troponin C; slow twitch skeletal/cardiac muscle troponin C; troponin C type 1 (slow); troponin C1, slow; troponin C1, slow skeletal and cardiac type |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgacatctacaaggctgcggtagagcagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggcgctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccagaaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggcacggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaagggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggctacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcacggaggacgacatcgaggagctcatgaaggacggagacaagaacaacgacggccgcatcgactatgatgagttcctggagttcatgaagggtgtggagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ring finger protein 185 - GM2 ganglioside activator - density-regulated protein - zinc finger protein 323 |