TNNC1-troponin C type 1 (slow) Gene View larger

TNNC1-troponin C type 1 (slow) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNNC1-troponin C type 1 (slow) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TNNC1-troponin C type 1 (slow) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030244
Product type: DNA & cDNA
Ncbi symbol: TNNC1
Origin species: Human
Product name: TNNC1-troponin C type 1 (slow) Gene
Size: 2ug
Accessions: BC030244
Gene id: 7134
Gene description: troponin C type 1 (slow)
Synonyms: CMD1Z; CMH13; TN-C; TNC; TNNC; troponin C, slow skeletal and cardiac muscles; cardiac troponin C; slow twitch skeletal/cardiac muscle troponin C; troponin C type 1 (slow); troponin C1, slow; troponin C1, slow skeletal and cardiac type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgacatctacaaggctgcggtagagcagctgacagaagagcagaaaaatgagttcaaggcagccttcgacatcttcgtgctgggcgctgaggatggctgcatcagcaccaaggagctgggcaaggtgatgaggatgctgggccagaaccccacccctgaggagctgcaggagatgatcgatgaggtggacgaggacggcagcggcacggtggactttgatgagttcctggtcatgatggttcggtgcatgaaggacgacagcaaagggaaatctgaggaggagctgtctgacctcttccgcatgtttgacaaaaatgctgatggctacatcgacctggatgagctgaagataatgctgcaggctacaggcgagaccatcacggaggacgacatcgaggagctcatgaaggacggagacaagaacaacgacggccgcatcgactatgatgagttcctggagttcatgaagggtgtggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 185
- GM2 ganglioside activator
- density-regulated protein
- zinc finger protein 323

Buy TNNC1-troponin C type 1 (slow) Gene now

Add to cart