KRT222P-keratin 222 pseudogene Gene View larger

KRT222P-keratin 222 pseudogene Gene

PTXBC032815

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRT222P-keratin 222 pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRT222P-keratin 222 pseudogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032815
Product type: DNA & cDNA
Ncbi symbol: KRT222P
Origin species: Human
Product name: KRT222P-keratin 222 pseudogene Gene
Size: 2ug
Accessions: BC032815
Gene id: 125113
Gene description: keratin 222 pseudogene
Synonyms: KRT222P; KA21; keratin-like protein KRT222; keratin 222, type II; keratin-222 pseudogene; keratin 222
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaactgtcccagctactcaatgagatcagggcaaactatgaaaagatcctcaccagaaatcagatagagacggtgctctcaacaaggatccagctagaagaagacataagcaaaaaaatggacaaagatgaagaggctttgaaggcagctcaagcagaactcaaggaggcccgacgccagtggcaccacctgcaagtggaaattgaatctctccatgctgtggaaaggggccttgaaaactccctacatgccagcgagcagcattaccagatgcagctgcaagacctagagactgtgattgaaggactagaaaaagagctacaggaagtaaggcgcggcatcgaaaagcagcttcaagagcacgagatgcttctcaacacgaagatgaggctggaacaagaaatagcaacttatcgccacctcctagaaaaagaagaaatcagatattatggttgtatccaaggtgggaaaaaagacaaaaagcctaccacaagtagagttggttttgttttaccatcagccattataaatgaaatatcttttactacaaaagtcccacaaaagtatgagaatgaaaatgtagaaacagtaaccaaacaggcaatcttaaatgggagtatcgttaaggagagcactgaagctcatggcactattcagacagagaaagtggatgaagttattaaagaatgggaaggttctttctttaaagataaccctcgattgaggaaaaagtctgtttctcttcgatttgatcttcatttagcagccactgatgaagggtgtttagagactaagcaggataatctaccagatatagaagtcaggcttatcatgagaagatcatgcagtattccctctatcaaacctccatcaacagctaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adenosine A2b receptor
- troponin C type 1 (slow)
- ring finger protein 185
- GM2 ganglioside activator

Buy KRT222P-keratin 222 pseudogene Gene now

Add to cart