GNMT-glycine N-methyltransferase Gene View larger

GNMT-glycine N-methyltransferase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNMT-glycine N-methyltransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNMT-glycine N-methyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032627
Product type: DNA & cDNA
Ncbi symbol: GNMT
Origin species: Human
Product name: GNMT-glycine N-methyltransferase Gene
Size: 2ug
Accessions: BC032627
Gene id: 27232
Gene description: glycine N-methyltransferase
Synonyms: HEL-S-182mP; glycine N-methyltransferase; epididymis secretory sperm binding protein Li 182mP
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtggacagcgtgtaccggacccgctccctgggggtggcggccgaagggctcccggaccagtacgcggacggggaggcggcgcgcgtgtggcagctgtatatcggagacacccgcagccgcaccgccgagtacaaggcatggctgcttgggctgctgcgccagcacggctgccagcgggtgctcgacgtagcctgtggcactggggtggactccattatgctggtggaagagggcttcagtgtgacgagtgtggatgccagtgacaagatgctgaagtatgcacttaaggagcgctggaaccggcggcacgagcccgccttcgacaagtgggtcatcgaagaagccaactggatgactctggacaaagatgtgccccagtcagcagagggtggctttgatgctgtcatctgccttggaaacagtttcgctcacttgccagactgcaaaggggaccagagtgagcaccggctggcgctgaaaaacattgcgagcatggtgcgggcagggggcctactggtcattgatcatcgcaactacgaccacatcctcagtacaggctgtgcacccccagggaagaacatctactataagagtgacttgaccaaggacgtcacaacatcagtgctgatagtgaacaacaaggcccacatggtgaccctggactatacggtgcaggtgccgggggctggccaggatggctctcctggcttgagtaagttccggctctcctactacccacactgtctggcatccttcacggagctgctccaagcagccttcggaggtaagtgccagcacagcgtcctgggcgacttcaagccttacaagccaggccaaacctacattccctgctacttcatccacgtgctcaagaggacagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycolipid transfer protein
- t-complex 10 (mouse)-like
- clathrin, light chain (Lca)
- regulator of calcineurin 2

Buy GNMT-glycine N-methyltransferase Gene now

Add to cart