Login to display prices
Login to display prices
TBCA-tubulin folding cofactor A Gene View larger

TBCA-tubulin folding cofactor A Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TBCA-tubulin folding cofactor A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TBCA-tubulin folding cofactor A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018210
Product type: DNA & cDNA
Ncbi symbol: TBCA
Origin species: Human
Product name: TBCA-tubulin folding cofactor A Gene
Size: 2ug
Accessions: BC018210
Gene id: 6902
Gene description: tubulin folding cofactor A
Synonyms: tubulin-specific chaperone A; CFA; TCP1-chaperonin cofactor A; chaperonin cofactor A; tubulin folding cofactor A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgatcctcgcgtgagacagatcaagatcaagaccggcgtggtgaagcggttggtcaaagaaaaagtgatgtatgaaaaagaggcaaaacaacaagaagaaaagattgaaaaaatgagagctgaagacggtgaaaattatgacattaaaaagcaggcagagatcctacaagaatccaggatgatgatcccagattgccagcgcaggttggaagccgcatatttggatcttcaacggatactagaaaatgaaaaagacttggaagaagctgaggaatataaagaagcacgtttagtactggattcagtgaagttagaagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prostaglandin reductase 1
- retinoid X receptor, alpha
- DPY30 domain containing 2
- high-mobility group box 1