RXRA-retinoid X receptor, alpha Gene View larger

RXRA-retinoid X receptor, alpha Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RXRA-retinoid X receptor, alpha Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RXRA-retinoid X receptor, alpha Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007925
Product type: DNA & cDNA
Ncbi symbol: RXRA
Origin species: Human
Product name: RXRA-retinoid X receptor, alpha Gene
Size: 2ug
Accessions: BC007925
Gene id: 6256
Gene description: retinoid X receptor, alpha
Synonyms: NR2B1; retinoic acid receptor RXR-alpha; nuclear receptor subfamily 2 group B member 1; retinoid X nuclear receptor alpha; retinoid X receptor alpha
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttggaagctggcctgccaggaccttccaccctggggcctgtgtcagccgccggccctccgcaccctggaagcacacggcctctgggaaggacagccctgaccttcggttttccgagcacggtgtttcccaagaattctgggctggcggcctggtggcagtgctggagatgaccccgagcccctccccgtggggcacccaggagggccctgccggaatgtgcagcctgtgggtagtcggctggtgtccctgtcgtggagctggggtgcgtgatctggtgctcgtccacgcaggtgtgtggtgtaaacatgtatgtgctgtacagagagacgcgtgtggagagagccgcacaccagcgccacccaggaaaggcggagcggttaccagtgttttgtgtttatttttaatcaagacgtttcccctgttttcctataaatttgcttcgtgtaagcaagtacataaggaccctcctttggtgaaatccgggttcgaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DPY30 domain containing 2
- high-mobility group box 1
- NudC domain containing 3
- acyl-CoA thioesterase 11

Buy RXRA-retinoid X receptor, alpha Gene now

Add to cart