Login to display prices
Login to display prices
PTGR1-prostaglandin reductase 1 Gene View larger

PTGR1-prostaglandin reductase 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTGR1-prostaglandin reductase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTGR1-prostaglandin reductase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035228
Product type: DNA & cDNA
Ncbi symbol: PTGR1
Origin species: Human
Product name: PTGR1-prostaglandin reductase 1 Gene
Size: 2ug
Accessions: BC035228
Gene id: 22949
Gene description: prostaglandin reductase 1
Synonyms: LTB4DH; PGR1; ZADH3; prostaglandin reductase 1; 15-oxoprostaglandin 13-reductase; NADP-dependent leukotriene B4 12-hydroxydehydrogenase; PRG-1; leukotriene B4 12-hydroxydehydrogenase; zinc binding alcohol dehydrogenase domain containing 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttcgtactaagacatggaccctgaagaagcactttgttggctatcctactaatagtgactttgagttgaagacatctgagctcccacccttaaaaaatggagaggtcctgcttgaagctttgttcctcaccgtggatccctacatgagagtggcagccaaaagattgaaggaaggtgatacaatgatggggcagcaagtggccaaagttgtggaaagtaaaaatgtagccctaccaaaaggaactattgtactggcttctccaggctggacaacgcactccatttctgatgggaaagatctggaaaagctgctgacagagtggccagacacaataccactgtctttggctctggggacagttggcatgccaggcctgactgcctactttggcctacttgaaatctgtggtgtgaagggtggagaaacagtgatggttaatgcagcagctggagctgtgggctcagtcgtggggcagattgcaaagctcaagggctgcaaagttgttggagcagtagggtctgatgaaaaggttgcctaccttcaaaagcttggatttgatgtcgtctttaactacaagacggtagagtctttggaagaaaccttgaagaaagcgtctcctgatggttatgattgttattttgataatgtaggtggagagttttcaaacactgttatcggccagatgaagaaatttggaaggattgccatatgtggagccatctctacatataacagaaccggcccacttcccccaggcccacccccagagattgttatctatcaggagcttcgcatggaagcttttgtcgtctaccgctggcaaggagatgcccgccaaaaagctctgaaggacttgctgaaatgggtcttagagggtaaaatccagtacaaggaatatatcattgaaggatttgaaaacatgccagccgcatttatgggaatgctgaaaggagataatttggggaagacaatagtgaaagcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - retinoid X receptor, alpha
- DPY30 domain containing 2
- high-mobility group box 1
- NudC domain containing 3