Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of S100A16-S100 calcium binding protein A16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about S100A16-S100 calcium binding protein A16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010541 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | S100A16 |
| Origin species: | Human |
| Product name: | S100A16-S100 calcium binding protein A16 Gene |
| Size: | 2ug |
| Accessions: | BC010541 |
| Gene id: | 140576 |
| Gene description: | S100 calcium binding protein A16 |
| Synonyms: | AAG13; DT1P1A7; S100F; protein S100-A16; aging-associated gene 13 protein; aging-associated protein 13; protein S100-F; S100 calcium binding protein A16 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagactgctacacggagctggagaaggcagtcattgtcctggtggaaaacttctacaaatatgtgtctaagtacagcctggtcaagaacaagatcagcaagagcagcttccgcgagatgctccagaaagagctgaaccacatgctgtcggacacagggaaccggaaggctgcggataagctcatccagaacctggatgccaatcatgatgggcgcatcagcttcgatgagtactggaccttgataggcggcatcaccggccccatcgccaaactcatccatgagcaggagcagcagagcagcagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dynein, light chain, Tctex-type 3 - dihydrodiol dehydrogenase (dimeric) - zinc finger CCCH-type containing 3 - regenerating islet-derived 1 alpha |