S100A16-S100 calcium binding protein A16 Gene View larger

S100A16-S100 calcium binding protein A16 Gene

PTXBC010541

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A16-S100 calcium binding protein A16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A16-S100 calcium binding protein A16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010541
Product type: DNA & cDNA
Ncbi symbol: S100A16
Origin species: Human
Product name: S100A16-S100 calcium binding protein A16 Gene
Size: 2ug
Accessions: BC010541
Gene id: 140576
Gene description: S100 calcium binding protein A16
Synonyms: AAG13; DT1P1A7; S100F; protein S100-A16; aging-associated gene 13 protein; aging-associated protein 13; protein S100-F; S100 calcium binding protein A16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagactgctacacggagctggagaaggcagtcattgtcctggtggaaaacttctacaaatatgtgtctaagtacagcctggtcaagaacaagatcagcaagagcagcttccgcgagatgctccagaaagagctgaaccacatgctgtcggacacagggaaccggaaggctgcggataagctcatccagaacctggatgccaatcatgatgggcgcatcagcttcgatgagtactggaccttgataggcggcatcaccggccccatcgccaaactcatccatgagcaggagcagcagagcagcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dynein, light chain, Tctex-type 3
- dihydrodiol dehydrogenase (dimeric)
- zinc finger CCCH-type containing 3
- regenerating islet-derived 1 alpha

Buy S100A16-S100 calcium binding protein A16 Gene now

Add to cart