CCL5-chemokine (C-C motif) ligand 5 Gene View larger

CCL5-chemokine (C-C motif) ligand 5 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCL5-chemokine (C-C motif) ligand 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCL5-chemokine (C-C motif) ligand 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008600
Product type: DNA & cDNA
Ncbi symbol: CCL5
Origin species: Human
Product name: CCL5-chemokine (C-C motif) ligand 5 Gene
Size: 2ug
Accessions: BC008600
Gene id: 6352
Gene description: chemokine (C-C motif) ligand 5
Synonyms: D17S136E; SCYA5; SIS-delta; SISd; TCP228; eoCP; C-C motif chemokine 5; T-cell specific protein p288; beta-chemokine RANTES; chemokine (C-C motif) ligand 5; eosinophil chemotactic cytokine; regulated upon activation, normally T-expressed, and presumably secreted; small inducible cytokine subfamily A (Cys-Cys), member 5; C-C motif chemokine ligand 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggtctccgcggcagccctcgctgtcatcctcattgctactgccctctgcgctcctgcatctgcctccccatattcctcggacaccacaccctgctgctttgcctacattgcccgcccactgccccgtgcccacatcaaggagtatttctacaccagtggcaagtgctccaacccagcagtcgtctttgtcacccgaaagaaccgccaagtgtgtgccaacccagagaagaaatgggttcgggagtacatcaactctttggagatgagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-C motif) ligand 2
- G protein-coupled receptor 55
- G protein-coupled receptor 65
- interleukin 20 receptor beta

Buy CCL5-chemokine (C-C motif) ligand 5 Gene now

Add to cart