Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL5-chemokine (C-C motif) ligand 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL5-chemokine (C-C motif) ligand 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008600 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL5 |
| Origin species: | Human |
| Product name: | CCL5-chemokine (C-C motif) ligand 5 Gene |
| Size: | 2ug |
| Accessions: | BC008600 |
| Gene id: | 6352 |
| Gene description: | chemokine (C-C motif) ligand 5 |
| Synonyms: | D17S136E; SCYA5; SIS-delta; SISd; TCP228; eoCP; C-C motif chemokine 5; T-cell specific protein p288; beta-chemokine RANTES; chemokine (C-C motif) ligand 5; eosinophil chemotactic cytokine; regulated upon activation, normally T-expressed, and presumably secreted; small inducible cytokine subfamily A (Cys-Cys), member 5; C-C motif chemokine ligand 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggtctccgcggcagccctcgctgtcatcctcattgctactgccctctgcgctcctgcatctgcctccccatattcctcggacaccacaccctgctgctttgcctacattgcccgcccactgccccgtgcccacatcaaggagtatttctacaccagtggcaagtgctccaacccagcagtcgtctttgtcacccgaaagaaccgccaagtgtgtgccaacccagagaagaaatgggttcgggagtacatcaactctttggagatgagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-C motif) ligand 2 - G protein-coupled receptor 55 - G protein-coupled receptor 65 - interleukin 20 receptor beta |