Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL2-chemokine (C-C motif) ligand 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL2-chemokine (C-C motif) ligand 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009716 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL2 |
| Origin species: | Human |
| Product name: | CCL2-chemokine (C-C motif) ligand 2 Gene |
| Size: | 2ug |
| Accessions: | BC009716 |
| Gene id: | 6347 |
| Gene description: | chemokine (C-C motif) ligand 2 |
| Synonyms: | GDCF-2; HC11; HSMCR30; MCAF; MCP1; SCYA2; SMC-CF; C-C motif chemokine 2; chemokine (C-C motif) ligand 2; monocyte chemoattractant protein-1; monocyte chemotactic and activating factor; monocyte chemotactic protein 1; monocyte secretory protein JE; small inducible cytokine A2 (monocyte chemotactic protein 1, homologous to mouse Sig-je); small inducible cytokine subfamily A (Cys-Cys), member 2; small-inducible cytokine A2; C-C motif chemokine ligand 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagtctctgccgcccttctgtgcctgctgctcatagcagccaccttcattccccaagggctcgctcagccagatgcaatcaatgccccagtcacctgctgttataacttcaccaataggaagatctcagtgcagaggctcgcgagctatagaagaatcaccagcagcaagtgtcccaaagaagctgtgatcttcaagaccattgtggccaaggagatctgtgctgaccccaagcagaagtgggttcaggattccatggaccacctggacaagcaaacccaaactccgaagacttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G protein-coupled receptor 55 - G protein-coupled receptor 65 - interleukin 20 receptor beta - LY6/PLAUR domain containing 4 |