CCL2-chemokine (C-C motif) ligand 2 Gene View larger

CCL2-chemokine (C-C motif) ligand 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCL2-chemokine (C-C motif) ligand 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCL2-chemokine (C-C motif) ligand 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009716
Product type: DNA & cDNA
Ncbi symbol: CCL2
Origin species: Human
Product name: CCL2-chemokine (C-C motif) ligand 2 Gene
Size: 2ug
Accessions: BC009716
Gene id: 6347
Gene description: chemokine (C-C motif) ligand 2
Synonyms: GDCF-2; HC11; HSMCR30; MCAF; MCP1; SCYA2; SMC-CF; C-C motif chemokine 2; chemokine (C-C motif) ligand 2; monocyte chemoattractant protein-1; monocyte chemotactic and activating factor; monocyte chemotactic protein 1; monocyte secretory protein JE; small inducible cytokine A2 (monocyte chemotactic protein 1, homologous to mouse Sig-je); small inducible cytokine subfamily A (Cys-Cys), member 2; small-inducible cytokine A2; C-C motif chemokine ligand 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagtctctgccgcccttctgtgcctgctgctcatagcagccaccttcattccccaagggctcgctcagccagatgcaatcaatgccccagtcacctgctgttataacttcaccaataggaagatctcagtgcagaggctcgcgagctatagaagaatcaccagcagcaagtgtcccaaagaagctgtgatcttcaagaccattgtggccaaggagatctgtgctgaccccaagcagaagtgggttcaggattccatggaccacctggacaagcaaacccaaactccgaagacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor 55
- G protein-coupled receptor 65
- interleukin 20 receptor beta
- LY6/PLAUR domain containing 4

Buy CCL2-chemokine (C-C motif) ligand 2 Gene now

Add to cart