Login to display prices
Login to display prices
MGC5590-hypothetical protein MGC5590 Gene View larger

MGC5590-hypothetical protein MGC5590 Gene

PTXBC000868

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC5590-hypothetical protein MGC5590 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC5590-hypothetical protein MGC5590 Gene

Proteogenix catalog: PTXBC000868
Ncbi symbol: MGC5590
Product name: MGC5590-hypothetical protein MGC5590 Gene
Size: 2ug
Accessions: BC000868
Gene id: 79024
Gene description: hypothetical protein MGC5590
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagctggggagaggattgatgccagccagctgcctcacagggtgctggaaacacgtggccatgccattagcatcctgttcggcttctggacgagtttcatctgtgacacctacatagtcctcgcttggatcagcaagataaaaggcagccctgatgttagtgcctcctctgatgagccatacgccagaatccagcagagcagaaggcaatgccacgcagaagaggaccaaagtcaggtgccagaagcaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: