Login to display prices
Login to display prices
ARL17-ADP-ribosylation factor-like 17 Gene View larger

ARL17-ADP-ribosylation factor-like 17 Gene

PTXBC000924

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARL17-ADP-ribosylation factor-like 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARL17-ADP-ribosylation factor-like 17 Gene

Proteogenix catalog: PTXBC000924
Ncbi symbol: ARL17
Product name: ARL17-ADP-ribosylation factor-like 17 Gene
Size: 2ug
Accessions: BC000924
Gene id: 641522
Gene description: ADP-ribosylation factor-like 17
Synonyms: ARL17; ARL17A; ARL17P1; ADP-ribosylation factor-like 17 pseudogene 1; ADP-ribosylation factor-like protein 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaaaggaggtagaagtcatcctttcctcccccatagcagcaggtgtgcaggctctggtggtcagctggactccatactcccccaccagtcaccagcctggggaccgtggggctgcaaggacctcagcagcggtttcccaagtttcctgacttcttccatcctctggaaatcagctgtggttcgtgagccacacatctccccacaccaagctcctccatacaagacctcggactgcatcacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: