Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SET-SET nuclear oncogene Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SET-SET nuclear oncogene Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032749 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SET |
| Origin species: | Human |
| Product name: | SET-SET nuclear oncogene Gene |
| Size: | 2ug |
| Accessions: | BC032749 |
| Gene id: | 6418 |
| Gene description: | SET nuclear oncogene |
| Synonyms: | SET nuclear proto-oncogene; SET translocation (myeloid leukemia-associated); SET nuclear oncogene; protein SET; 2PP2A; I2PP2A; IGAAD; IPP2A2; PHAPII; TAF-I; TAF-IBETA; HLA-DR-associated protein II; Template-Activating Factor-I, chromatin remodelling factor; inhibitor of granzyme A-activated DNase; inhibitor-2 of protein phosphatase-2A; phosphatase 2A inhibitor I2PP2A; protein phosphatase type 2A inhibitor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggcgccggcggccaaagtcagtaaaaaggagctcaactccaaccacgacggggccgacgagacctcagaaaaagaacagcaagaagcgattgaacacattgatgaagtacaaaatgaaatagacagacttaatgaacaagccagtgaggagattttgaaagtagaacagaaatataacaaactccgccaaccattttttcagaagaggtcagaattgatcgccaaaatcccaaatttttgggtaacaacatttgtcaaccatccacaagtgtctgcactgcttggggaggaagatgaagaggcactgcattatttgaccagagttgaagtgacagaatttgaagatattaaatcaggttacagaatagatttttattttgatgaaaatccttactttgaaaataaagttctctccaaagaatttcatctgaatgagagtggtgatccatcttcgaagtccaccgaaatcaaatggaaatctggaaaggatttgacgaaacgttcgagtcaaacgcagaataaagccagcaggaagaggcagcatgaggaaccagagagcttctttacctggtttactgaccattctgatgcaggtgctgatgagttaggagaggtcatcaaagatgatatttggccaaacccattacagtactacttggttcccgatatggatgatgaagaaggagaaggagaagaagatgatgatgatgatgaagaggaggaaggattagaagatattgacgaagaaggggatgaggatgaaggtgaagaagatgaagatgatgatgaaggggaggaaggagaggaggatgaaggagaagatgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - apolipoprotein C-I - PARK2 co-regulated - carbonic anhydrase I - ERGIC and golgi 3 |