SET-SET nuclear oncogene Gene View larger

SET-SET nuclear oncogene Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SET-SET nuclear oncogene Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SET-SET nuclear oncogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032749
Product type: DNA & cDNA
Ncbi symbol: SET
Origin species: Human
Product name: SET-SET nuclear oncogene Gene
Size: 2ug
Accessions: BC032749
Gene id: 6418
Gene description: SET nuclear oncogene
Synonyms: SET nuclear proto-oncogene; SET translocation (myeloid leukemia-associated); SET nuclear oncogene; protein SET; 2PP2A; I2PP2A; IGAAD; IPP2A2; PHAPII; TAF-I; TAF-IBETA; HLA-DR-associated protein II; Template-Activating Factor-I, chromatin remodelling factor; inhibitor of granzyme A-activated DNase; inhibitor-2 of protein phosphatase-2A; phosphatase 2A inhibitor I2PP2A; protein phosphatase type 2A inhibitor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggcgccggcggccaaagtcagtaaaaaggagctcaactccaaccacgacggggccgacgagacctcagaaaaagaacagcaagaagcgattgaacacattgatgaagtacaaaatgaaatagacagacttaatgaacaagccagtgaggagattttgaaagtagaacagaaatataacaaactccgccaaccattttttcagaagaggtcagaattgatcgccaaaatcccaaatttttgggtaacaacatttgtcaaccatccacaagtgtctgcactgcttggggaggaagatgaagaggcactgcattatttgaccagagttgaagtgacagaatttgaagatattaaatcaggttacagaatagatttttattttgatgaaaatccttactttgaaaataaagttctctccaaagaatttcatctgaatgagagtggtgatccatcttcgaagtccaccgaaatcaaatggaaatctggaaaggatttgacgaaacgttcgagtcaaacgcagaataaagccagcaggaagaggcagcatgaggaaccagagagcttctttacctggtttactgaccattctgatgcaggtgctgatgagttaggagaggtcatcaaagatgatatttggccaaacccattacagtactacttggttcccgatatggatgatgaagaaggagaaggagaagaagatgatgatgatgatgaagaggaggaaggattagaagatattgacgaagaaggggatgaggatgaaggtgaagaagatgaagatgatgatgaaggggaggaaggagaggaggatgaaggagaagatgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - apolipoprotein C-I
- PARK2 co-regulated
- carbonic anhydrase I
- ERGIC and golgi 3

Buy SET-SET nuclear oncogene Gene now

Add to cart