Login to display prices
Login to display prices
CA1-carbonic anhydrase I Gene View larger

CA1-carbonic anhydrase I Gene

PTXBC027890

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CA1-carbonic anhydrase I Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CA1-carbonic anhydrase I Gene

Proteogenix catalog: PTXBC027890
Ncbi symbol: CA1
Product name: CA1-carbonic anhydrase I Gene
Size: 2ug
Accessions: BC027890
Gene id: 759
Gene description: carbonic anhydrase I
Synonyms: CA-I; CAB; Car1; HEL-S-11; carbonic anhydrase 1; carbonate dehydratase I; carbonic anhydrase B; carbonic anhydrase I; epididymis secretory protein Li 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaagtccagactggggatatgatgacaaaaatggtcctgaacaatggagcaagctgtatcccattgccaatggaaataaccagtcccctgttgatattaaaaccagtgaaaccaaacatgacacctctctgaaacctattagtgtctcctacaacccagccacagccaaagaaattatcaatgtggggcattccttccatgtaaattttgaggacaacgataaccgatcagtgctgaaaggtggtcctttctctgacagctacaggctctttcagttccattttcactggggcagtacaaatgagcatggttcagaacatacagtggatggagtcaaatattctgccgagcttcacgtagctcactggaattctgcaaagtactccagccttgctgaagctgcctcaaaggctgatggtttggcagttattggtgttttgatgaaggttggtgaggccaacccaaagctgcagaaagtacttgatgccctccaagcaattaaaaccaagggcaaacgagccccattcacaaattttgacccctctactctccttccttcatccctggatttctggacctaccctggctctctgactcatcctcctctttatgagagtgtaacttggatcatctgtaaggagagcatcagtgtcagctcagagcagctggcacaattccgcagccttctatcaaatgttgaaggtgataacgctgtccccatgcagcacaacaaccgcccaacccaacctctgaagggcagaacagtgagagcttcattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: