APOC1-apolipoprotein C-I Gene View larger

APOC1-apolipoprotein C-I Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOC1-apolipoprotein C-I Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APOC1-apolipoprotein C-I Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009698
Product type: DNA & cDNA
Ncbi symbol: APOC1
Origin species: Human
Product name: APOC1-apolipoprotein C-I Gene
Size: 2ug
Accessions: BC009698
Gene id: 341
Gene description: apolipoprotein C-I
Synonyms: Apo-CI; ApoC-I; apo-CIB; apoC-IB; apolipoprotein C-I; apolipoprotein C1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggctcttcctgtcgctcccggtcctggtggtggttctgtcgatcgtcttggaaggcccagccccagcccaggggaccccagacgtctccagtgccttggataagctgaaggagtttggaaacacactggaggacaaggctcgggaactcatcagccgcatcaaacagagtgaactttctgccaagatgcgggagtggttttcagagacatttcagaaagtgaaggagaaactcaagattgactcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PARK2 co-regulated
- carbonic anhydrase I
- ERGIC and golgi 3
- tubulin, alpha 3c

Buy APOC1-apolipoprotein C-I Gene now

Add to cart