LOC404266-hypothetical LOC404266 Gene View larger

LOC404266-hypothetical LOC404266 Gene

PTXBC010732

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC404266-hypothetical LOC404266 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC404266-hypothetical LOC404266 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010732
Product type: DNA & cDNA
Ncbi symbol: LOC404266
Origin species: Human
Product name: LOC404266-hypothetical LOC404266 Gene
Size: 2ug
Accessions: BC010732
Gene id: 404266
Gene description: hypothetical LOC404266
Synonyms: HOXB cluster antisense RNA 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagtgctgccgggaacccagcgatatccgcaccagcggagaaggttccaggctgccggcggcggcgcagagagcgggaagagaggctcggaggaagccccgggcgtggcgtggtcaggctccgagagcggccgggatgcggccacaccggcctggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glycine N-methyltransferase
- glycolipid transfer protein
- t-complex 10 (mouse)-like
- clathrin, light chain (Lca)

Buy LOC404266-hypothetical LOC404266 Gene now

Add to cart