Login to display prices
Login to display prices
LOC404266-hypothetical LOC404266 Gene View larger

LOC404266-hypothetical LOC404266 Gene

PTXBC010732

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC404266-hypothetical LOC404266 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC404266-hypothetical LOC404266 Gene

Proteogenix catalog: PTXBC010732
Ncbi symbol: LOC404266
Product name: LOC404266-hypothetical LOC404266 Gene
Size: 2ug
Accessions: BC010732
Gene id: 404266
Gene description: hypothetical LOC404266
Synonyms: HOXB cluster antisense RNA 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccagtgctgccgggaacccagcgatatccgcaccagcggagaaggttccaggctgccggcggcggcgcagagagcgggaagagaggctcggaggaagccccgggcgtggcgtggtcaggctccgagagcggccgggatgcggccacaccggcctggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: