LOC541471-hypothetical LOC541471 Gene View larger

LOC541471-hypothetical LOC541471 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC541471-hypothetical LOC541471 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOC541471-hypothetical LOC541471 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014776
Product type: DNA & cDNA
Ncbi symbol: LOC541471
Origin species: Human
Product name: LOC541471-hypothetical LOC541471 Gene
Size: 2ug
Accessions: BC014776
Gene id: 541471
Gene description: hypothetical LOC541471
Synonyms: AGD2; LINC00978; MIR4435-1 host gene (non-protein coding)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagacactgaaaatcacgactcatccccctccagcacctctacctgttgcccgccgatcacagccggaatgcagctgaaagattccctggggcctggttccaactgcccactgtggactctgaggcctctgcatttgcgggtggtctgcctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC404266
- glycine N-methyltransferase
- glycolipid transfer protein
- t-complex 10 (mouse)-like

Buy LOC541471-hypothetical LOC541471 Gene now

Add to cart