ZNF616-zinc finger protein 616 Gene View larger

ZNF616-zinc finger protein 616 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF616-zinc finger protein 616 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF616-zinc finger protein 616 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032805
Product type: DNA & cDNA
Ncbi symbol: ZNF616
Origin species: Human
Product name: ZNF616-zinc finger protein 616 Gene
Size: 2ug
Accessions: BC032805
Gene id: 90317
Gene description: zinc finger protein 616
Synonyms: zinc finger protein 616
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggatactatgcagccatagaaaggaatgagatcatgtccattgcagcgatgtggatggagctggaagccattatcctcaggaaactaacacaggaacagaaaatcaaacagcacatgttctcacttaaaagtggaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 706
- keratin 222 pseudogene
- adenosine A2b receptor
- troponin C type 1 (slow)

Buy ZNF616-zinc finger protein 616 Gene now

Add to cart