Cart 1 Product Products 113,40 € (empty)
-
1 x LZIC-leuci...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of LIM2-lens intrinsic membrane protein 2, 19kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LIM2-lens intrinsic membrane protein 2, 19kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126139 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LIM2 |
| Origin species: | Human |
| Product name: | LIM2-lens intrinsic membrane protein 2, 19kDa Gene |
| Size: | 2ug |
| Accessions: | BC126139 |
| Gene id: | 3982 |
| Gene description: | lens intrinsic membrane protein 2, 19kDa |
| Synonyms: | CTRCT19; MP17; MP19; lens fiber membrane intrinsic protein; MP18; MP20; lens intrinsic membrane protein 2, 19kDa; lens intrinsic membrane protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtacagcttcatgggtggtggcctgttctgtgcctgggtggggaccatcctcctggtggtggccatggcaacagaccactggatgcagtaccggctgtcagggtccttcgcccaccagggcctgtggcggtactgcctgggcaacaagtgctacctgcagacagacagcatcggtgagccccccggccagggtccaggccgcgcctggggaaagagcagggcggacctcggggcccaaggacacctgtattccagatggagaactctgcggctcaaagagggaaagggagcaacccaagcatactggaatgccacccgggccttcatgatcctgtctgccctatgcgccatctccggcatcatcatgggcatcatggccttcgctcatcagcctaccttctcccgcatctcccggcccttctctgctggcatcatgtttttttcctcaacccttttcgtcgtgttggccttggccatctacactggagtcaccgtcagcttcctgggccgccgctttggggactggcgcttttcctggtcctacatcctgggctgggtggcagtgctcatgacgttcttcgcagggattttctacatgtgcgcctaccgggtgcatgaatgccggcgcctgtctacaccccgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gonadotropin-releasing hormone receptor - glucose-6-phosphatase, catalytic subunit - sterile alpha motif domain containing 7 - SET nuclear oncogene |