Cart 8 Product Products 1 142,66 € (empty)
-
1 x RPL11-ribo...113,40 € -
-
1 x RPL17-ribo...113,40 € -
1 x ANXA2-anne...121,50 € -
1 x C9orf6-chr...113,40 € -
1 x AGER-advan...121,50 € -
-
No products
To be determined Shipping
1 142,66 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 142,66 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 142,66 €
View larger 
Data sheet of GNRHR-gonadotropin-releasing hormone receptor Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNRHR-gonadotropin-releasing hormone receptor Gene
| Proteogenix catalog: | PTXBC113546 |
| Ncbi symbol: | GNRHR |
| Product name: | GNRHR-gonadotropin-releasing hormone receptor Gene |
| Size: | 2ug |
| Accessions: | BC113546 |
| Gene id: | 2798 |
| Gene description: | gonadotropin-releasing hormone receptor |
| Synonyms: | GNRHR1; GRHR; HH7; LHRHR; LRHR; gonadotropin-releasing hormone receptor; gnRH receptor; gnRH-R; gonadotropin-releasing hormone (type 1) receptor 1; leutinizing hormone releasing horomone receptor; leutinizing-releasing hormone receptor; luliberin receptor; type I GnRH receptor; gonadotropin releasing hormone receptor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaacagtgcctctcctgaacagaatcaaaatcactgttcagccatcaacaacagcatcccactgatgcagggcaacctccccactctgaccttgtctggaaagatccgagtgacggttactttcttcctttttctgctctctgcgacctttaatgcttctttcttgttgaaacttcagaagtggacacagaagaaagagaaagggaaaaagctctcaagaatgaagctgctcttaaaacatctgaccttagccaacctgttggagactctgattgtcatgccactggatgggatgtggaacattacagtccaatggtatgctggagagttactctgcaaagttctcagttatctaaagcttttctccatgtatgccccagccttcatgatggtggtgatcagcctggaccgctccctggctatcacgaggcccctagctttgaaaagcaacagcaaagtcggacagtccatggttggcctggcctggatcctcagtagtgtctttgcaggaccacagttatacatcttcaggatgattcatctagcagacagctctggacagacaaaagttttctctcaatgtgtaacacactgcagtttttcacaatggtggcatcaagcattttataactttttcaccttcagctgcctcttcatcatccctcttttcatcatgctgatctgcaatgcaaaaatcatcttcaccctgacacgggtccttcatcaggacccccacgaactacaactgaatcagtccaagaacaatataccaagagcacggctgaagactctaaaaatgacggttgcatttgccacttcatttactgtctgctggactccctactatgtcctaggaatttggtattggtttgatcctgaaatgttaaacaggttgtcagacccagtaaatcacttcttctttctctttgcctttttaaacccatgctttgatccacttatctatggatatttttctctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |