Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM30A-family with sequence similarity 30, member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM30A-family with sequence similarity 30, member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030286 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM30A |
| Origin species: | Human |
| Product name: | FAM30A-family with sequence similarity 30, member A Gene |
| Size: | 2ug |
| Accessions: | BC030286 |
| Gene id: | 29064 |
| Gene description: | family with sequence similarity 30, member A |
| Synonyms: | FAM30A; C14orf110 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagaccccttctcccaggaggggagagcctggagacacaggccccatccttcccaatggggacacttcagggagcggctctcaggtcccgagaaagaccttcctggccacaggagacacacggacatcgggaacggacggaggaaggatgtgcagttgcagccttttcagcagacgccctgagaacgggaggtcaagagttggagcagacgacagggcctcagacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 98, member C - zinc finger protein 616 - zinc finger protein 706 - keratin 222 pseudogene |