> >>GADD45B-growth arrest and DNA-damage-inducible, beta Gene
GADD45B-growth arrest and DNA-damage-inducible, beta Gene View larger

GADD45B-growth arrest and DNA-damage-inducible, beta Gene

PTXBC113466

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of GADD45B-growth arrest and DNA-damage-inducible, beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GADD45B-growth arrest and DNA-damage-inducible, beta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC113466
Product type: DNA & cDNA
Ncbi symbol: GADD45B
Origin species: Human
Product name: GADD45B-growth arrest and DNA-damage-inducible, beta Gene
Size: 2ug
Accessions: BC113466
Gene id: 4616
Gene description: growth arrest and DNA-damage-inducible, beta
Synonyms: GADD45BETA; MYD118; growth arrest and DNA damage-inducible protein GADD45 beta; myeloid differentiation primary response protein MyD118; negative growth regulatory protein MyD118; growth arrest and DNA damage inducible beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgctggaagagctcgtggcgtgcgacaacgcggcgcagaagatgcagacggtgaccgccgcggtggaggagcttttggtggccgctcagcgccaggatcgcctcacagtgggggtgtacgagtcggccaagttgatgaatgtggacccagacagcgtggtcctctgcctcttggccattgacgaggaggaggaggatgacatcgccctgcaaatccacttcacgctcatccagtccttctgctgtgacaacgacatcaacatcgtgcgggtgtcgggcatgcagcgcctggcgcagctcctgggagagccggccgagacccagggcaccaccgaggcccgagacctgcattgtctcctggtcacgaaccctcacacggacgcctggaagagccacggcttggtggaggtggccagctactgcgaagaaagccggggcaacaaccagtgggtcccctacatctctcttcaggaacgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, Class I, type 8B family pseudogene
- OCIA domain containing 2
- tubulin folding cofactor A
- prostaglandin reductase 1

Reviews

Buy GADD45B-growth arrest and DNA-damage-inducible, beta Gene now

Add to cart