PTXBC113466
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113466 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GADD45B |
| Origin species: | Human |
| Product name: | GADD45B-growth arrest and DNA-damage-inducible, beta Gene |
| Size: | 2ug |
| Accessions: | BC113466 |
| Gene id: | 4616 |
| Gene description: | growth arrest and DNA-damage-inducible, beta |
| Synonyms: | GADD45BETA; MYD118; growth arrest and DNA damage-inducible protein GADD45 beta; myeloid differentiation primary response protein MyD118; negative growth regulatory protein MyD118; growth arrest and DNA damage inducible beta |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgctggaagagctcgtggcgtgcgacaacgcggcgcagaagatgcagacggtgaccgccgcggtggaggagcttttggtggccgctcagcgccaggatcgcctcacagtgggggtgtacgagtcggccaagttgatgaatgtggacccagacagcgtggtcctctgcctcttggccattgacgaggaggaggaggatgacatcgccctgcaaatccacttcacgctcatccagtccttctgctgtgacaacgacatcaacatcgtgcgggtgtcgggcatgcagcgcctggcgcagctcctgggagagccggccgagacccagggcaccaccgaggcccgagacctgcattgtctcctggtcacgaaccctcacacggacgcctggaagagccacggcttggtggaggtggccagctactgcgaagaaagccggggcaacaaccagtgggtcccctacatctctcttcaggaacgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, Class I, type 8B family pseudogene - OCIA domain containing 2 - tubulin folding cofactor A - prostaglandin reductase 1 |