Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TR2IT1-thioredoxin reductase 2 intronic transcript 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TR2IT1-thioredoxin reductase 2 intronic transcript 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130546 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TR2IT1 |
| Origin species: | Human |
| Product name: | TR2IT1-thioredoxin reductase 2 intronic transcript 1 Gene |
| Size: | 2ug |
| Accessions: | BC130546 |
| Gene id: | 645840 |
| Gene description: | thioredoxin reductase 2 intronic transcript 1 |
| Synonyms: | TR2IT1; TXNRD3IT1; TXNRD3NT1; protein TXNRD3NB; TXNRD3 neighbor gene protein; thioredoxin reductase 2 intronic transcript 1; thioredoxin reductase 3 intronic transcript 1; thioredoxin reductase 3 neighbor gene protein; thioredoxin reductase 3 new transcript 1; thioredoxin reductase 3 neighbor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggacctgagcgagaggagacttgggcagccggagctgaaagctgagcagcagatgccactggagcctgtgagggcacgattgagtgtggggctggcttgctgctgctcccacaccactgcagaggcgtcctctctggaacatggagacaaggtttttggacaggggtttcccagtcccctggaagagattaagagactactgaagatctccagggcactgcaagccagatctgtaccctccacccaggagaaggcaaaatgtctttctggagagcctgggcagccagaggggaaaggtcaagaaacctatcctggccctgggaaagtggagggtaaggcagagccagccatgagaaaggatgatgtttgcccaggcatgaaatgtatcagcggatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - growth arrest and DNA-damage-inducible, beta - ATPase, Class I, type 8B family pseudogene - OCIA domain containing 2 - tubulin folding cofactor A |