PTXBC030798
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC030798 |
Product type: | DNA & cDNA |
Ncbi symbol: | FTO |
Origin species: | Human |
Product name: | FTO-fat mass and obesity associated Gene |
Size: | 2ug |
Accessions: | BC030798 |
Gene id: | 79068 |
Gene description: | fat mass and obesity associated |
Synonyms: | FTO, alpha-ketoglutarate dependent dioxygenase; alpha-ketoglutarate-dependent dioxygenase FTO; ALKBH9; BMIQ14; GDFD; AlkB homolog 9; fat mass and obesity associated; fat mass and obesity-associated protein |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggagtggaggaaagtcagcgaatgtaatagtgtcgaaccctgcagggaagttaagaagtggccataccgttgcattcatcatgggaagaatttcagtagaatgacaaatgctgtgcttcatgaagttaaaagagaggggctccccgtggaacaaaggaatgaaatcttgactgccatccttgcctcgctcactgcacgccagaacctgaggagagaatggcatgccaggtgccagtcacgaattgcccgaacattacctgctgatcagaagccagaatgtcggccatactgggaaaaggatgatgcttcgatgcctctgccgtttgacctcacagacatcgtttcagaactcagaggtcagcttctggaagcaaaaccctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - hypothetical LOC149950 - chemokine (C-C motif) ligand 8 - chemokine (C-C motif) ligand 7 - hypothetical LOC149837 |