Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL8-chemokine (C-C motif) ligand 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL8-chemokine (C-C motif) ligand 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126242 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL8 |
| Origin species: | Human |
| Product name: | CCL8-chemokine (C-C motif) ligand 8 Gene |
| Size: | 2ug |
| Accessions: | BC126242 |
| Gene id: | 6355 |
| Gene description: | chemokine (C-C motif) ligand 8 |
| Synonyms: | HC14; MCP-2; MCP2; SCYA10; SCYA8; C-C motif chemokine 8; chemokine (C-C motif) ligand 8; monocyte chemoattractant protein 2; monocyte chemotactic protein 2; small inducible cytokine subfamily A (Cys-Cys), member 8 (monocyte chemotactic protein 2); small-inducible cytokine A8; C-C motif chemokine ligand 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggtttctgcagcgcttctgtgcctgctgctcatggcagccactttcagccctcagggacttgctcagccagattcagtttccattccaatcacctgctgctttaacgtgatcaataggaaaattcctatccagaggctggagagctacacaagaatcaccaacatccaatgtcccaaggaagctgtgatcttcaagacccaacggggcaaggaggtctgtgctgaccccaaggagagatgggtcagggattccatgaagcatctggaccaaatatttcaaaatctgaagccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chemokine (C-C motif) ligand 7 - hypothetical LOC149837 - orofacial cleft 1 candidate 1 - NIPA-like domain containing 2 |