Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCL7-chemokine (C-C motif) ligand 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL7-chemokine (C-C motif) ligand 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC112258 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL7 |
| Origin species: | Human |
| Product name: | CCL7-chemokine (C-C motif) ligand 7 Gene |
| Size: | 2ug |
| Accessions: | BC112258 |
| Gene id: | 6354 |
| Gene description: | chemokine (C-C motif) ligand 7 |
| Synonyms: | FIC; MARC; MCP-3; MCP3; NC28; SCYA6; SCYA7; C-C motif chemokine 7; chemokine (C-C motif) ligand 7; monocyte chemoattractant protein 3; monocyte chemotactic protein 3; small inducible cytokine A7 (monocyte chemotactic protein 3); small-inducible cytokine A7; C-C motif chemokine ligand 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagcctctgcagcacttctgtgtctgctgctcacagcagctgctttcagcccccaggggcttgctcagccagttgggattaatacttcaactacctgctgctacagatttatcaataagaaaatccctaagcagaggctggagagctacagaaggaccaccagtagccactgtccccgggaagctgtaatcttcaagaccaaactggacaaggagatctgtgctgaccccacacagaagtgggtccaggactttatgaagcacctggacaagaaaacccaaactccaaagctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical LOC149837 - orofacial cleft 1 candidate 1 - NIPA-like domain containing 2 - tescalcin |