TESC-tescalcin Gene View larger

TESC-tescalcin Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TESC-tescalcin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TESC-tescalcin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015221
Product type: DNA & cDNA
Ncbi symbol: TESC
Origin species: Human
Product name: TESC-tescalcin Gene
Size: 2ug
Accessions: BC015221
Gene id: 54997
Gene description: tescalcin
Synonyms: CHP3; TSC; calcineurin B homologous protein 3; calcineurin-like EF hand protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgctgcccactccgcgtctgaggaggtgcgggagctcgagggcaagaccggcttctcatcggatcagatcgagcagctccatcggagatttaagcagctgagtggagatcagcctaccattcgcaaggagaacttcaacaatgtcccggacctggagctcaaccccatccgatccaaaattgttcgtgccttcttcgacaacaggaacctgcgcaagggacccagtggcctggctgatgagatcaatttcgaggacttcctgaccatcatgtcctacttccggcccatcgacaccaccatggacgaggaacaggtggagctgtcccggaaggagaagctgagatttctgttccacatgtacgactcggacagcgacggccgcatcactctggaagaatatcgaaatgtggtcgaggagctgctgtcgggaaaccctcacatcgagaaggagtccgctcgctccatcgccgacggggccatgatggaggcggccagcgtgtgcatggggcagatggagcctgatcaggtgtacgaggggatcaccttcgaggacttcctgaagatctggcaggggatcgacattgagaccaagatgcacgtccgcttccttaacatggaaaccatggccctctgccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - JTV1 gene
- septin 6
- matrin 3
- sarcolipin

Buy TESC-tescalcin Gene now

Add to cart