JTV1-JTV1 gene Gene View larger

JTV1-JTV1 gene Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of JTV1-JTV1 gene Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about JTV1-JTV1 gene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002853
Product type: DNA & cDNA
Ncbi symbol: JTV1
Origin species: Human
Product name: JTV1-JTV1 gene Gene
Size: 2ug
Accessions: BC002853
Gene id: 7965
Gene description: JTV1 gene
Synonyms: JTV1; JTV-1; P38; aminoacyl tRNA synthase complex-interacting multifunctional protein 2; ARS-interacting multi-functional protein 2; multisynthase complex auxiliary component p38; multisynthetase complex auxiliary component p38; protein JTV-1; aminoacyl tRNA synthetase complex interacting multifunctional protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgatgtaccaggtaaagccctatcacgggggcggcgcgcctctccgtgtggagcttcccacctgcatgtaccggctccccaacgtgcacggcaggagctacggcccagcgccgggcgctggccacgtgcaggaagagtctaacctgtctctgcaagctcttgagtcccgccaagatgatattttaaaacgtctgtatgagttgaaagctgcagttgatggcctctccaagatgattcaaacaccagatgcagacttggatgtaaccaacataatccaagcggatgagcccacgactttaaccaccaatgcgctggacttgaattcagtgcttgggaaggattacggggcgctgaaagacatcgtgatcaacgcaaacccggcctcccctcccctctccctgcttgtgctgcacaggctgctctgtgagcacttcagggtcctgtccacggtgcacacgcactcctcggtcaagagcgtgcctgaaaaccttctcaagtgctttggagaacagaataaaaaacagccccgccaagactatcagctgggattcactttaatttggaagaatgtgccgaagacgcagatgaaattcagcatccagacgatgtgccccatcgaaggcgaagggaacattgcacgtttcttgttctctctgtttggccagaagcataatgctgtcaacgcaacccttatagatagctgggtagatattgcgatttttcagttaaaagagggaagcagtaaagaaaaagccgctgttttccgctccatgaactctgctcttgggaagagcccttggctcgctgggaatgaactcaccgtagcagacgtggtgctgtggtctgtactccagcagatcggaggctgcagtgtgacagtgccagccaatgtgcagaggtggatgaggtcttgtgaaaatctggctccttttaacacggccctcaagctccttaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - septin 6
- matrin 3
- sarcolipin
- metaxin 1

Buy JTV1-JTV1 gene Gene now

Add to cart