Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TIAF1-TGFB1-induced anti-apoptotic factor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIAF1-TGFB1-induced anti-apoptotic factor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131561 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIAF1 |
| Origin species: | Human |
| Product name: | TIAF1-TGFB1-induced anti-apoptotic factor 1 Gene |
| Size: | 2ug |
| Accessions: | BC131561 |
| Gene id: | 9220 |
| Gene description: | TGFB1-induced anti-apoptotic factor 1 |
| Synonyms: | MAJN; SPR210; TGFB1-induced anti-apoptotic factor 1; 12 kDa TGF-beta-1-induced antiapoptotic factor; TGF-beta-1-induced antiapoptotic factor 1; molecule associated with Jak-3 N-terminal |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcatctccatcttcacccttcagagagcagtcctttctctgtgcagctggagacgctggtgaggagagccgggtccaggttcttaagaatgaggtgcggaggggctctccggtgctgctgggctgggttgagcaagcctacgcagacaagtgtgtgtgtggaccatccgcacctccagcccccaccccaccctctttgtctcagcgtgttatgtgcaatgacctatttaaggtaaacccattccaactacagcagttcagggctgatccaagcactgcctccctcctgctctgtccaggtggtctggaccataaactcaacttgagagggaaggcttggggttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eosinophil lysophospholipase-like - fms-related tyrosine kinase 3 ligand - Mix1 homeobox-like 1 (Xenopus laevis) - solute carrier family 35, member E2 |