> >>FLT3LG-fms-related tyrosine kinase 3 ligand Gene
FLT3LG-fms-related tyrosine kinase 3 ligand Gene View larger

FLT3LG-fms-related tyrosine kinase 3 ligand Gene

PTXBC028001

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of FLT3LG-fms-related tyrosine kinase 3 ligand Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FLT3LG-fms-related tyrosine kinase 3 ligand Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028001
Product type: DNA & cDNA
Ncbi symbol: FLT3LG
Origin species: Human
Product name: FLT3LG-fms-related tyrosine kinase 3 ligand Gene
Size: 2ug
Accessions: BC028001
Gene id: 2323
Gene description: fms-related tyrosine kinase 3 ligand
Synonyms: FLT3L; fms-related tyrosine kinase 3 ligand; flt3 ligand; fms related tyrosine kinase 3 ligand
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcggctcaagactgtcgctgggtccaagatgcaaggcttgctggagcgcgtgaacacggagatacactttgtcaccaaatgtgcctttcagcccccccccagctgtcttcgcttcgtccagaccaacatctcccgcctcctgcaggagacctccgagcagctggtggcgctgaagccctggatcactcgccagaacttctcccggtgcctggagctgcagtgtcagcccgactcctcaaccctgccacccccatggagtccccggcccctggaggccacagccccgacagccccgcagccccctctgctcctcctactgctgctgcccgtgggcctcctgctgctggccgctgcctggtgcctgcactggcagaggacgcggcggaggacaccccgccctggggagcaggtgccccccgtccccagtccccaggacctgctgcttgtggagcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Mix1 homeobox-like 1 (Xenopus laevis)
- solute carrier family 35, member E2
- proline-rich protein BstNI subfamily 4
- thyrotropin-releasing hormone receptor

Reviews

Buy FLT3LG-fms-related tyrosine kinase 3 ligand Gene now

Add to cart