Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MIXL1-Mix1 homeobox-like 1 (Xenopus laevis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MIXL1-Mix1 homeobox-like 1 (Xenopus laevis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113441 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MIXL1 |
| Origin species: | Human |
| Product name: | MIXL1-Mix1 homeobox-like 1 (Xenopus laevis) Gene |
| Size: | 2ug |
| Accessions: | BC113441 |
| Gene id: | 83881 |
| Gene description: | Mix1 homeobox-like 1 (Xenopus laevis) |
| Synonyms: | homeobox protein MIXL1; MILD1; MIX; MIXL; MIX1 homeobox-like protein 1; Mix-like homeobox protein 1; homeodomain protein MIX; mix.1 homeobox-like protein; Mix paired-like homeobox |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccacagccgagtcccgtgcgctccagtttgccgagggcgccgcgtttccagcgtaccgggccccccacgccggcggggcgctcctgccgcccccgagccctgcggcagccctgctccctgcgccgcccgcgggccccggcccagcgacctttgcgggcttcctcggccgggaccccgggccggccccgccgccccccgccagcctgggctcgcctgcgccccccaaaggcgcggccgccccgtcggcgtcgcagcgccgcaagcgcacgtctttcagcgccgaacagctgcagctgctggagctcgtcttccgccggacccggtaccccgacatccacttgcgcgagcgcctggccgcgctcaccctgctccccgagtccaggatccaggtatggttccagaacaggcgtgccaagtctcggcgtcagagtgggaaatccttccaacctttggctaggccggagattatcctcaaccactgtgctcctggaactgaaacgaaatgtctgaagccccagctgcctcttgaggtagatgtgaactgcctgcccgaaccaaacggggttggagggggcatctctgactctagctcccaaggtcagaattttgaaacctgttcccctctctctgaagacattggttcaaagctggactcatgggaggaacacatcttttctgcctttggtaacttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 35, member E2 - proline-rich protein BstNI subfamily 4 - thyrotropin-releasing hormone receptor - solute carrier family 35, member D2 |