Cart 1 Product Products 113,40 € (empty)
-
1 x ABCD3-ATP-...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC128211 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASCL4 |
| Origin species: | Human |
| Product name: | ASCL4-achaete-scute complex homolog 4 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC128211 |
| Gene id: | 121549 |
| Gene description: | achaete-scute complex homolog 4 (Drosophila) |
| Synonyms: | class II bHLH protein ASCL4; HASH4; bHLHa44; achaete-scute homolog 4; ASH-4; achaete-scute complex homolog 4; achaete-scute complex-like 4; achaete-scute-like protein 4; class A basic helix-loop-helix protein 44; achaete-scute family bHLH transcription factor 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagacgcgtaaaccggcggaacggctggccttgccatactcgctgcgcaccgcgcccctgggcgttccggggaccctgcccggactcccgcggagggaccccctcagggtcgccctgcgtctggacgccgcgtgctgggagtgggcgcgcagcggctgcgcacggggatggcagtacttgcccgtgccgctggacagcgccttcgagcccgccttcctccgcaagcgcaacgagcgcgagcggcagcgggtgcgctgcgtgaacgagggctatgcgcgcctccgagaccacctgccccgggagctggcagacaagcgcctcagcaaagtggagacgctccgcgctgccatcgactacatcaagcacctgcaggagctgctggagcgccaggcctgggggctcgagggcgcggccggcgccgtcccccagcgcagggcggaatgcaacagcgacggggagtccaaggcctcttcggcgccttcgcccagcagcgagcccgaggaggggggcagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to TBC1 domain family, member 2B - arginine-rich, mutated in early stage tumors - heterogeneous nuclear ribonucleoprotein A3 - ribosomal protein L27a |