Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GPIHBP1-glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 Gene
PTXBC035810
New product
Data sheet of GPIHBP1-glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPIHBP1-glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035810 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPIHBP1 |
| Origin species: | Human |
| Product name: | GPIHBP1-glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC035810 |
| Gene id: | 338328 |
| Gene description: | glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 |
| Synonyms: | GPI-HBP1; HYPL1D; glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1; GPI anchored high density lipoprotein binding protein 1; GPI-anchored HDL-binding protein 1; endothelial cell LPL transporter; glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggcgctcggggctgtcctgcttgccctcttgctgtgcgggcggccagggagagggcagacacagcaggaggaagaggaagaggacgaggaccacgggccagatgactacgacgaggaagatgaggatgaggttgaagaggaggagaccaacaggctccctggtggcaggagcagagtgctgctgcggtgctacacctgcaagtccctgcccagggacgagcgctgcaacctgacgcagaactgctcacatggccagacctgcacaaccctcattgcccacgggaacaccgagtcaggcctcctgaccacccactccacgtggtgcacagacagctgccagcccatcaccaagacggtggaggggacccaggtgaccatgacctgctgccagtccagcctgtgcaatgtcccaccctggcaaagctcccgagtccaggacccaacaggcaagggggcaggcggcccccggggcagctccgaaactgtgggcgcagccctcctgctcaacctccttgccggccttggagcaatgggggccaggagaccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldo-keto reductase family 1, member A1 (aldehyde reductase) - NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa - potassium voltage-gated channel, KQT-like subfamily, member 2 - translocase of outer mitochondrial membrane 6 homolog (yeast) |