Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LDLRAD1-low density lipoprotein receptor class A domain containing 1 Gene
PTXBC127708
New product
Data sheet of LDLRAD1-low density lipoprotein receptor class A domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LDLRAD1-low density lipoprotein receptor class A domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC127708 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LDLRAD1 |
| Origin species: | Human |
| Product name: | LDLRAD1-low density lipoprotein receptor class A domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC127708 |
| Gene id: | 388633 |
| Gene description: | low density lipoprotein receptor class A domain containing 1 |
| Synonyms: | low-density lipoprotein receptor class A domain-containing protein 1; low density lipoprotein receptor class A domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacaaggtcttcccccagggagagaatggctacactgctgctgaatccaaagcccaccctggaggggaagcaggcggcggccacctctgctgctcacgtcgcggggcctgcctctctgcctctctgctgctcctcctggcaactgtggcggccctcatcgccttggtcaccattcttggactcccatcatgcaccccaggagcccaagcttgtataacactgacaaacaggacaggcttcttgtgccatgaccagaggagctgcattccagccagtggggtctgtgatggcgttcgcacctgtacccacggcgaggacgaggatgagagcttgtgccgagatgtgccccagagcctcccccacttccttgtggcccactgtggagacccggcctcctggatctactcagaccaaaaatgtgatggcactaacaactgcggggactgttcagatgaactgagcccagtaactgtgtgcccaccctgcggccctgggtggtggcgctgtccttcaaccttcttcaagtactgcgactgtataccgaggcatctctgccgcgaccatgtacagcactgctccgactggtccgatgagtatgcctgtcccggaccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 86, member A pseudogene - coagulation factor VII (serum prothrombin conversion accelerator) - transmembrane and coiled-coil domains 5A - cholinergic receptor, nicotinic, alpha 7 |