Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ADH7-alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene
PTXBC131512
New product
Data sheet of ADH7-alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ADH7-alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131512 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ADH7 |
| Origin species: | Human |
| Product name: | ADH7-alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC131512 |
| Gene id: | 131 |
| Gene description: | alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide |
| Synonyms: | ADH4; alcohol dehydrogenase class 4 mu/sigma chain; alcohol dehydrogenase VII; alcohol dehydrogenase class IV mu/sigma chain; alcohol dehydrogenase-7; class IV sigma-1 alcohol dehydrogenase; class IV sigmasigma alcohol dehydrogenase; gastric alcohol dehydrogenase; retinol dehydrogenase; alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttgcagaaatacagatccaagacaaagacaggatgggcactgctggaaaagttattaaatgcaaagcagctgtgctttgggagcagaagcaacccttctccattgaggaaatagaagttgccccaccaaagactaaagaagttcgcattaagattttggccacaggaatctgtcgcacagatgaccatgtgataaaaggaacaatggtgtccaagtttccagtgattgtgggacatgaggcaactgggattgtagagagcattggagaaggagtgactacagtgaaaccaggtgacaaagtcatccctctctttctgccacaatgtagagaatgcaatgcttgtcgcaacccagatggcaacctttgcattaggagcgatattactggtcgtggagtactggctgatggcaccaccagatttacatgcaagggcaaaccagtccaccacttcatgaacaccagtacatttaccgagtacacagtggtggatgaatcttctgttgctaagattgatgatgcagctcctcctgagaaagtctgtttaattggctgtgggttttccactggatatggcgctgctgttaaaactggcaaggtcaaacctggttccacttgcgtcgtctttggcctgggaggagttggcctgtcagtcatcatgggctgtaagtcagctggtgcatctaggatcattgggattgacctcaacaaagacaaatttgagaaggccatggctgtaggtgccactgagtgtatcagtcccaaggactctaccaaacccatcagtgaggtgctgtcagaaatgacaggcaacaacgtgggatacacctttgaagttattgggcatcttgaaaccatgattgatgccctggcatcctgccacatgaactatgggaccagcgtggttgtaggagttcctccatcagccaagatgctcacctatgacccgatgttgctcttcactggacgcacatggaagggatgtgtctttggaggtttgaaaagcagagatgatgtcccaaaactagtgactgagttcctggcaaagaaatttgacctggaccagttgataactcatgttttaccatttaaaaaaatcagtgaaggatttgagctgctcaattcaggacaaagcattcgaacggtcctgacgttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal peptidase complex subunit 2 homolog (S. cerevisiae) - family with sequence similarity 12, member B (epididymal) - proteasome (prosome, macropain) inhibitor subunit 1 (PI31) - ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) |