Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPCS2-signal peptidase complex subunit 2 homolog (S. cerevisiae) Gene
PTXBC082231
New product
Data sheet of SPCS2-signal peptidase complex subunit 2 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPCS2-signal peptidase complex subunit 2 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC082231 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPCS2 |
| Origin species: | Human |
| Product name: | SPCS2-signal peptidase complex subunit 2 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC082231 |
| Gene id: | 9789 |
| Gene description: | signal peptidase complex subunit 2 homolog (S. cerevisiae) |
| Synonyms: | signal peptidase complex subunit 2; SPase 25 kDa subunit; microsomal signal peptidase 25 kDa subunit; signal peptidase 25kDa subunit; signal peptidase complex subunit 2 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacccctttccagagtccaaacccgttttggctttgtgtgtcatatcctattttgtgatgatggggattctgaccatttatacctcatataaggagaagagcatctttctcgtggcccacaggaaagatcctacaggaatggatcctgatgatatttggcagctgtcctccagtcttaaaaggtttgatgacaaatacaccttgaagctgaccttcatcagtgggagaacaaagcagcagcgggaagccgagttcacaaagtccattgctaagttttttgaccacagtgggacactggtcatggatgcatatgagcctgaaatatccaggctccatgacagtcttgccatagaaagaaaaataaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 12, member B (epididymal) - proteasome (prosome, macropain) inhibitor subunit 1 (PI31) - ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast) - signaling lymphocytic activation molecule family member 1 |