Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CABC1-chaperone, ABC1 activity of bc1 complex homolog (S. pombe) Gene
PTXBC129930
New product
Data sheet of CABC1-chaperone, ABC1 activity of bc1 complex homolog (S. pombe) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CABC1-chaperone, ABC1 activity of bc1 complex homolog (S. pombe) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC129930 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CABC1 |
| Origin species: | Human |
| Product name: | CABC1-chaperone, ABC1 activity of bc1 complex homolog (S. pombe) Gene |
| Size: | 2ug |
| Accessions: | BC129930 |
| Gene id: | 56997 |
| Gene description: | chaperone, ABC1 activity of bc1 complex homolog (S. pombe) |
| Synonyms: | CABC1; ADCK3; ARCA2; COQ10D4; COQ8; SCAR9; atypical kinase COQ8A, mitochondrial; aarF domain-containing protein kinase 3; atypical kinase ADCK3, mitochondrial; chaperone activity of bc1 complex-like, mitochondrial; chaperone, ABC1 activity of bc1 complex homolog; coenzyme Q protein 8A; coenzyme Q8 homolog; coenzyme Q8A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgccatattgggagacaccatcatggtggctaaaggccttgtcaagctgacccaggcggccgtggaaacccacctgcagcacttgggcatcggaggggagctgatcatggcggccagggccctgcagtccacggctgtggagcagattggcatgttcttggggaaggtgcagggtcaggataaacatgaagaatattttgctgagaacttcggcggcccagaaggggagttccacttctcagtcccgcatgcagccggagcctccacagacttctcttcagcctccgctcccgaccagtcagcgcccccatccctgggtcatgcccacagcgagggcccagctcctgcctacgtggccagtggaccctttagagaagccgggttccccggccaggcctcctcccctctgggcagggccaacgggaggctctttgcaaaccccagagactcattctctgccatgggctttcagcgaaggttcttccaccaggaccaatcccctgttgggggcctcacagccgaggacattgagaaggcccggcaggctaaggctcgccccgagaacaagcagcacaaacagacgctcagcgagcatgcccgggagcggaaggtgcctgtgacgaggattggccggctggccaacttcggaggtctggccgtgggcctgggcttcggggcactggcagaggtcgccaagaagagcctgcgctccgaggacccctcagggaagaaggccgtgctgggttccagtcctttcctgtccgaggccaatgcagagcggatcgtgcgcacgctctgcaaggtgcgtggtgcggcactcaagctgggccagatgctgagcatccaggatgatgcctttatcaacccccacctggctaagatcttcgagcgggtgcggcagagcgcggacttcatgccactgaagcagatgatgaaaactctcaacaacgacctgggccccaactggcgggacaagttggaatacttcgaggagcggcccttcgccgccgcatccattgggcaggtgcacttggcccgaatgaagggcggccgcgaggtggccatgaagatccagtaccctggcgtggcccagagcatcaacagtgatgtcaacaacctcatggccgtgttgaacatgagcaacatgcttccagaaggcctgttccccgagcacctgatcgacgtgctgaggcgggagctggccctggagtgtgactaccagcgatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide - signal peptidase complex subunit 2 homolog (S. cerevisiae) - family with sequence similarity 12, member B (epididymal) - proteasome (prosome, macropain) inhibitor subunit 1 (PI31) |