Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H3B-histone cluster 1, H3b Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H3B-histone cluster 1, H3b Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096132 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H3B |
| Origin species: | Human |
| Product name: | HIST1H3B-histone cluster 1, H3b Gene |
| Size: | 2ug |
| Accessions: | BC096132 |
| Gene id: | 8358 |
| Gene description: | histone cluster 1, H3b |
| Synonyms: | H3/l; H3FL; histone H3.1; H3 histone family, member L; histone 1, H3b; histone H3/l; histone cluster 1, H3b; histone cluster 1 H3 family member b |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcgtactaaacagacagctcggaaatccaccggcggtaaagcgccacgcaagcagctggctaccaaggctgctcgcaagagcgcgccggctaccggcggcgtgaaaaagcctcaccgttaccgcccgggcactgtggctctgcgcgagatccgccgctaccaaaagtcgaccgagttgctgattcggaagctgccgttccagcgcctggtgcgagaaatcgcccaagacttcaagaccgatcttcgcttccagagctctgcggtgatggcgctgcaggaggcttgtgaggcctacttggtagggctctttgaggacacaaacctttgcgccatccatgctaagcgagtgactattatgcccaaagacatccagctcgctcgccgcattcgcggagaaagagcgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fibroblast growth factor 6 - spindlin family, member 4 - histone cluster 1, H1e - hypothetical LOC147664 |