Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H1E-histone cluster 1, H1e Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H1E-histone cluster 1, H1e Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096168 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H1E |
| Origin species: | Human |
| Product name: | HIST1H1E-histone cluster 1, H1e Gene |
| Size: | 2ug |
| Accessions: | BC096168 |
| Gene id: | 3008 |
| Gene description: | histone cluster 1, H1e |
| Synonyms: | H1.4; H1E; H1F4; H1s-4; dJ221C16.5; histone H1.4; H1 histone family, member 4; histone 1, H1e; histone H1b; histone H1s-4; histone cluster 1, H1e; histone cluster 1 H1 family member e |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgagactgcgcctgccgcgcccgctgctccggcccctgccgagaagactcccgtgaagaagaaggcccgcaagtctgcaggtgcggccaagcgcaaagcgtctgggcccccggtgtccgagctcattactaaagctgttgccgcctccaaggagcgcagcggcgtatctttggccgctctcaagaaagcgctggcagccgctggctatgacgtggagaagaacaacagccgcatcaagctgggtctcaagagcctggtgagcaagggcaccctggtgcagaccaagggcaccggcgcgtcgggttccttcaaactcaacaagaaggcggcctctggggaagccaagcctaaggctaaaaaggcaggcgcggccaaggccaagaagccagcaggagcggcgaagaagcccaagaaggcgacgggggcggccacccccaagaagagcgccaagaagaccccaaagaaggcgaagaagccggctgcagctgctggagccaaaaaagcgaaaagcccgaaaaaggcgaaagcagccaagccaaaaaaggcgcccaagagcccagcgaaggccaaagcagttaaacccaaggcggctaaaccaaagaccgccaagcccaaggcagccaagccaaagaaggcggcagccaagaaaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical LOC147664 - PRAME family member 15 - SPOC domain containing 1 - HEAT repeat containing 6 |