Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FGF6-fibroblast growth factor 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FGF6-fibroblast growth factor 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121097 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FGF6 |
| Origin species: | Human |
| Product name: | FGF6-fibroblast growth factor 6 Gene |
| Size: | 2ug |
| Accessions: | BC121097 |
| Gene id: | 2251 |
| Gene description: | fibroblast growth factor 6 |
| Synonyms: | HBGF-6; HST2; fibroblast growth factor 6; FGF-6; HST-2; HSTF-2; heparin secretory-transforming protein 2; heparin-binding growth factor 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctgggacagaaactgttcatcactatgtcccggggagcaggacgtctgcagggcacgctgtgggctctcgtcttcctaggcatcctagtgggcatggtggtgccctcgcctgcaggcacccgtgccaacaacacgctgctggactcgaggggctggggcaccctgctgtccaggtctcgcgcggggctagctggagagattgccggggtgaactgggaaagtggctatttggtggggatcaagcggcagcggaggctctactgcaacgtgggcatcggctttcacctccaggtgctccccgacggccggatcagcggaacccacgaggagaacccctacagcctgctggaaatttccaccgtggagcgaggcgtggtgagtctctttggagtgagaagtgccctcttcgtcgccatgaacagtaaaggaagattgtacgcaacgcccagcttccaagaagaatgcaagttcagagaaaccctcctgcccaacaattacaatgcctacgagtcagacttgtaccaagggacctacattgccctgagcaaatacggacgggtaaagcggggcagcaaggtgtccccgatcatgactgtcactcatttccttcccaggatctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - spindlin family, member 4 - histone cluster 1, H1e - hypothetical LOC147664 - PRAME family member 15 |