Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNP2-transition protein 2 (during histone to protamine replacement) Gene
PTXBC096135
New product
Data sheet of TNP2-transition protein 2 (during histone to protamine replacement) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNP2-transition protein 2 (during histone to protamine replacement) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096135 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNP2 |
| Origin species: | Human |
| Product name: | TNP2-transition protein 2 (during histone to protamine replacement) Gene |
| Size: | 2ug |
| Accessions: | BC096135 |
| Gene id: | 7142 |
| Gene description: | transition protein 2 (during histone to protamine replacement) |
| Synonyms: | TP2; nuclear transition protein 2; TP-2; transition protein 2 (during histone to protamine replacement); transition protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacacccagactcacagccttcctatcacccacactcagctccatagcaactctcagccccaaagccgcacctgcacccgccattgccaaaccttcagccagagttgcagacagagccatcgtggcagccggagccagagctccagccagagcccggccagccaccgcaacccaactggagcccacagctcatccggccaccagagccagagtcccaacactagtccaccaccaaagcgccacaaaaagactatgaactcccaccactctcccatgcggcccaccatcctgcactgccgctgccccaagaacagaaagaacttggaaggcaagctgaaaaagaaaaaaatggccaagaggatccagcaggtgtacaaaaccaagacgcggagctcaggatggaaatccaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) - mannose-binding lectin (protein C) 2, soluble (opsonic defect) - carcinoembryonic antigen-related cell adhesion molecule 21 - solute carrier organic anion transporter family, member 1B1 |