Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
B3GAT2-beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) Gene
PTXBC113995
New product
Data sheet of B3GAT2-beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about B3GAT2-beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113995 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | B3GAT2 |
| Origin species: | Human |
| Product name: | B3GAT2-beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) Gene |
| Size: | 2ug |
| Accessions: | BC113995 |
| Gene id: | 135152 |
| Gene description: | beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) |
| Synonyms: | GLCATS; galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2; UDP-glucuronosyltransferase S; UDP-glucuronyltransferase S; glcAT-D; glucuronosyltransferase S; uridine diphosphate glucuronic acid:acceptor glucuronosyltransferase; beta-1,3-glucuronyltransferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtccgcgcttttcacccgcttctttatcctcctgccctggatcctaattgtcatcatcatgctcgacgtggacacgcgcaggccagtgcccccgctcaccccgcgcccctacttctctccctacgcggtgggccgcgggggcgcccgactcccgctccgcaggggcggcccggctcacgggacccaaaagcgcaaccagtctcggccgcagccacagccggagccgcagctgcccaccatctatgccatcacgcccacctacagccgcccggtgcagaaagcggagctgacccgcctggccaacacgttccgccaggtggcgcagctgcactggatcctggtggaggacgcggcggcgcgcagcgagcagatgcgaaccacccgcaaggtctccgtctggcctgtgggcctggttggtgggcggcgctacgaacgtccgctggtggaaaacggcaaagttgttggctggtacaccggctggagagcagacaggccttttgccatcgacatggcaggatttgctgtaagtcttcaagtcattttgtccaatccaaaagctgtatttaagcgtcgtggatcccagccagggatgcaagaatctgactttctcaaacagataacaacagtcgaagaactggaaccgaaagcaaataactgcactaaggttctcgtgtggcacactcggacagagaaggttaatctagccaacgagccaaagtaccacctggacacagtgaaaattgaggtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mannose-binding lectin (protein C) 2, soluble (opsonic defect) - carcinoembryonic antigen-related cell adhesion molecule 21 - solute carrier organic anion transporter family, member 1B1 - ubiquitously transcribed tetratricopeptide repeat, X chromosome |