SLCO1B1-solute carrier organic anion transporter family, member 1B1 Gene View larger

SLCO1B1-solute carrier organic anion transporter family, member 1B1 Gene


New product

Data sheet of SLCO1B1-solute carrier organic anion transporter family, member 1B1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLCO1B1-solute carrier organic anion transporter family, member 1B1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC114376
Product type: DNA & cDNA
Ncbi symbol: SLCO1B1
Origin species: Human
Product name: SLCO1B1-solute carrier organic anion transporter family, member 1B1 Gene
Size: 2ug
Accessions: BC114376
Gene id: 10599
Gene description: solute carrier organic anion transporter family, member 1B1
Synonyms: HBLRR; LST-1; LST1; OATP-C; OATP1B1; OATP2; OATPC; SLC21A6; solute carrier organic anion transporter family member 1B1; OATP-2; liver-specific organic anion transporter 1; sodium-independent organic anion-transporting polypeptide 2; solute carrier family 21 (organic anion transporter), member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccaaaatcaacatttgaataaaacagcagaggcacaaccttcagagaataagaaaacaagatactgcaatggattgaagatgttcttggcagctctgtcactcagctttattgctaagacactaggtgcaattattatgaaaagttccatcattcatatagaacggagatttgagatatcctcttctcttgttggttttattgacggaagctttgaaattggaaatttgcttgtgattgtatttgtgagttactttggatccaaactacatagaccaaagttaattggaatcggttgtttcattatgggaattggaggtgttttgactgctttgccacatttcttcatgggatattacaggtattctaaagaaactaatatcgattcatcagaaaattcaacatcaaccttatccacttgtttaattaatcaaattttatcactcaatagagcatcaactgagatagtgggaaaaggttgtttaaaggaatctgggtcatacatgtggatatatgtgttcatgggtaatatgcttcgtggaataggggagactcccatagtaccactggggctttcttacattgatgattttgctaaagaaggacattcttctttgtatttaggtatattgaatgcaatagcaatgattggtccaatcattggctttaccctgggatctctgttttctaaaatgtacgtggatattggatatgtagatctaagcactatcaggataactcctactgattctcgatgggttggagcttggtggcttaatttccttgtgtctggactattctccattatttcttccataccattctttttcttgccccaaactccaaataaaccacaaaaagaaagaaaagcttcactgtctttgcatgtgctggaaacaaatgatgaaaaggatcaaacagctaatttgaccaatcaaggaaaaaatattaccaaaaatgtgactggttttttccagtcttttaaaagcatccttactaatcccctgtatgttatgtttgtgcttttgacgttgttacaagtaagcagctatattggtgcttttacttatgtcttcaaatacgtagagcaacagtatggtcagccttcatctaaggctaacatcttattgggagtcataaccatacctatttttgcaagtggaatgtttttaggaggatatatcattaaaaaattcaaactgaacaccgttggaattgccaaattctcatgttttactgctgtgatgtcattgtccttttacctattatattttttcatactctgtgaaaacaaatcagttgccggactaaccatgacctatgatggaaataatccagtgacatctcatagagatgtaccactttcttattgcaactcagactgcaattgtgatgaaagtcaatgggaaccagtctgtggaaacaatggaataacttacatctcaccctgtctagcaggttgcaaatcttcaagtggcaataaaaagcctatagtgttttacaactgcagttgtttggaagtaactggtctccagaacagaaattactcagcccatttgggtgaatgcccaagagatgatgcttgtacaaggaaattttacttttttgttgcaatacaagtcttgaatttatttttctctgcacttggaggcacctcacatgtcatgctgattgttaaaattgttcaacctgaattgaaatcacttgcactgggtttccactcaatggttatacgagcactaggaggaattctagctccaatatattttggggctctgattgatacaacgtgtataaagtggtccaccaacaactgtggcacacgtgggtcatgtaggacatataattccacatcattttcaagggtctacttgggcttgtcttcaatgttaagagtctcatcacttgttttatatattatattaatttatgccatgaagaaaaaatatcaagagaaagatatcaatgcatcagaaaatggaagtgtcatggatgaagcaaacttagaatccttaaataaaaataaacattttgtcccttctgctggggcagatagtgaaacacattgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ubiquitously transcribed tetratricopeptide repeat, X chromosome
- ADAM metallopeptidase with thrombospondin type 1 motif, 12
- calmodulin regulated spectrin-associated protein 1-like 1
- ADAM metallopeptidase with thrombospondin type 1 motif, 12

Buy SLCO1B1-solute carrier organic anion transporter family, member 1B1 Gene now

Add to cart